Oxidative Metabolism Genes in Ovarian Neoplasms

Cover Page


Cite item

Abstract

BACKGROUND: Reactive oxygen species play important and ambiguous role in carcinogenesis, and local oxidative metabolism may differ significantly from systemic metabolism and determine the processes occurring in tumor tissues.

AIM: This study aimed to examine the expressions of key oxidative metabolism genes, particularly CYB5R, POR, NOX4, SOD1, NFB, and NRF2, in ovarian neoplasm tissues, and determine cytochrome b5 reductase and cytochrome P450 reductase activity, blood neutrophil activity, and antioxidant indices in the blood plasma and peritoneal fluid.

MATERIALS AND METHODS: The study included two groups of patients: a study group (n = 10) with ovarian adenocarcinoma and a comparison group (n = 6) with benign ovarian neoplasms. The expressions of CYB5R1, CYB5R2/R4, CYB5R3, POR, BIRC3, NOX4, NRF2, NFB, SOD1, HMOX1, and BCL2 genes, cytochrome b5 reductase, and cytochrome P450 reductase activity, oxidative activity of blood neutrophils, and antioxidant potential of plasma and peritoneal fluid were evaluated in these two groups of women.

RESULTS: The expression levels of CYB5R3 and BCL2 were significantly lower in adenocarcinoma tissues. The activities of cytochrome b5 reductase and cytochrome P450 reductase increased in the group with adenocarcinoma. On average, the activity of blood neutrophils corresponded to the reference values. For blood plasma, the antioxidant capacity were not different, whereas the antioxidant capacity in the peritoneal fluid increased approximately twofold in ovarian cancer.

CONCLUSIONS: Significantly increased cytochrome b5 reductase activity in adenocarcinoma tissues may be a response to intracellular oxidative stress, whereas CYB5R3 gene expression may be reduced by a negative feedback mechanism. The activities of cytochrome P450 reductase and its gene change to a lesser extent in the presence of ovarian adenocarcinoma. The oxidative balance in the blood and peritoneal fluid correlated with the tissue expressions of NFB and NRF2.

Full Text

BACKGROUND

Ovarian cancer is one of the major causes of death in women from cancer diseases [1]. One of the main mechanisms of its pathogenesis is oxidative stress, which is involved in the occurrence, development, and progression of ovarian cancer and chemoresistance, since it causes phenotypic modifications of tumor cells through cross-interaction between tumor cells and the surrounding stroma. Oxidative stress leads to an adaptive response of cancer cells through metabolic reprograming in the short term, and genetic reprograming provides long-term adaptation, whereas reactive oxygen species (ROS) can contribute to molecular genetic changes causing cancer progression, and in contrast, long-term increased ROS levels have a cytotoxic effect and can induce activation of apoptotic pathways [2].

Oxidative stress, inflammation, and apoptosis are interrelated in carcinogenesis [3]. Inflammation, especially chronic inflammation, is characterized by sustained tissue damage, injury-induced cell proliferation and repair [4]. In ovarian cancer, oxidative stress regulates the expression of inflammatory genes and activates activator protein 1, hypoxia-inducible factor 1α, heat shock factor 1, universal transcription factor NF-κB, transcription factor NRF2, and tumor suppressor p53 [2]. NF-κB promotes the initiation of carcinogenesis and plays a crucial role in tumor cell proliferation and survival, but may also perform a protective function in ovarian cancer by regulating antioxidant gene expression [2]. Increased NF-κB activation in invasive malignant ovarian lesions compared with benign or borderline neoplasms confirms the relationship between carcinogenesis and systemic inflammation [5].

Elevated ROS levels activate NRF2 signaling, inducing the expression of antioxidant enzymes such as heme oxygenase (HMOX), catalase, superoxide dismutase (SOD), and glutathione transferase. NRF2 plays a critical anti-inflammatory role; however, although NRF2 helps maintain the stability of the normal environment of ovarian cells and genome under conditions of oxidative stress, it protects cancer cells from oxidative damage and from the effects of cytotoxic drugs, thereby increasing resistance to chemotherapy [2].

One of the main sites for the synthesis of intracellular ROS is microsomal respiratory chains, represented by reductases integrated into the membrane of the endoplasmic reticulum, which transport electrons from nicotinamide adenine dinucleotide (NADH; reduced form) or nicotinamide adenine dinucleotide phosphate (NADPH; reduced form) to cytochromes. NADH-dependent cytochrome b5 reductase (CYB5R) participates in the synthesis of cholesterol, elongation of fatty acids, and microsomal hydroxylation of xenobiotics and steroid hormones and is part of the transmembrane redox system, which maintains the antioxidants ascorbate and coenzyme Q10 in a reduced state and protects the cell from apoptosis [6].

The role of cytochrome b5 reductase in carcinogenesis has not been sufficiently studied; however, its increased expression is known to correlate with a poor prognosis in patients with estrogen receptor-negative breast cancer, and a decrease in the expression of the gene for this enzyme reduces significantly metastatic spreading to the lungs in a mouse model [7]. NADPH-dependent cytochrome P450 reductase (POR) reduces cytochrome P450 and can transfer an electron to cytochrome b5, heme oxygenase, squalene monooxygenase, and 7-dehydrocholesterol reductase. The most crucial task of this chain is to catalyze the metabolism of drugs, especially antitumor drugs [8]. Studies available in the literature are mainly focused on the participation of this enzyme in the metabolism of anticancer drugs.

This study aimed to analyze the expression of key genes involved in oxidative metabolism, inflammation, and apoptosis (CYB5R, POR, NOX4, SOD1, HMOX1, NFKB1, NRF2, BCL2, BIRC3) in ovarian adenocarcinoma tissues and determine the activity of cytochrome b5 reductase, cytochrome P450 reductase, and some indicators of oxidative metabolism (activity of blood neutrophils and antioxidant indicators of blood plasma and peritoneal fluid).

MATERIALS AND METHODS

Overall, 16 female patients aged 47–57 years were included. The main group consisted of 10 patients with histologically confirmed ovarian cancer (moderate and poorly differentiated serous adenocarcinoma), and the comparison group comprised 6 patients with benign ovarian tumors (serous-mucinous cystadenoma). The exclusion criteria were age >75 years and presence of multiple primary tumors of other locations. All patients signed voluntary informed consent for inclusion in the study and use of medical data obtained.

Surgical intervention and follow-up of patients were performed in the D.D. Pletnev City Clinical Hospital of the Moscow Department of Health, as well as the morphological verification of the diagnosis in the Anatomic Pathology Department. The study materials were samples of malignant tissue, peritoneal fluid, blood plasma, and whole blood obtained on the day of surgery. Blood and peritoneal fluid samples were transported in a vacutainer with Li-heparin at a temperature of +4°C and analyzed no later than 2 hours after the material collection. Tissue samples were transported in physiological solution (0.9% NaCl solution), and then divided into two parts: one part was frozen at −80°C and gene expression was studied a month later, and in the other part, the activity of microsomal reductases was determined no later than 2 hours after taking the material.

Evaluation of gene expression by polymerase chain reaction

The level of gene expression was assessed by real-time polymerase chain reaction (PCR). RNA was isolated from tissue using YellowSolve kits (Klonogen, Russia) according to standard methods, followed by phenol–chloroform extraction and precipitation with chloroform and isoamyl alcohol (49:1). The RNA concentration was determined using the Quant-iT RiboGreen RNA reagent dye (MoBiTec, Germany) on a plate reader (EnSpire equipment, Finland) λex = 487 nm, λfl = 524 nm. Reverse transcription was performed using reagents from Silex (Russia) according to standard methods.

PCR was performed using the appropriate primers (Synthol) and intercalating dye SYBR Green on a StepOnePlus device (Applied Biosystems, USA). The following primers (Syntol, Moscow, Russia) were used:

NRF2 (NFE2L2) (F: TCCAGTCAGAAACCAGTGGAT,

 

R: GAATGTCTGGCGCCAAA AGCTG);

N0X4

(F: TTGGGGCTAGGATTGTGTCTA,

R: GAGTGTTCGGCACATGGGTA);

BIRC3

(F: AAGCTACCTCTCAGCCTACTTT, R: CCACTGTTTTCTGTACCCGGA);

BCL2

(F: GCCTTCTTTGAGTTCGGTGG;

R: ATCTCCCGGTTGACGCTCT);

NFKB1

(F: CAGATGGCCCATACCTTCAAAT,

R: CGGAAACGAAATCCTCTCTGTT);

HM0X1

(F: TCCTGGCTCAGCCTCAAATG;

R: CGTTAAACACCTCCCTCCCC);

SODI

F: AGGGCATCATCAATTTCGAGC;

R: GCCCACCGTGI111ICTGGA);

POR

(F: GGGATGCGAGGCATGTCAG;

R: CAGGGCGTTGTCGATCTCT);

CYB5R1

(F: TCAGGCCATACACTCCTGTCA;

R: CACACCCCTTCAGGTAGACCTT);

CYB5R2

(F: CAAGGGGACGCTTGTTTTACC;

R: AGGTGATCGGCCAGTGTTTTT);

CYB5R3

(F: TCTACCTCTCGGCTCGAATTG;

R: CCTTGTCATCATCGCTGGAGAT);

TBP (эталонный ген) (F: GCCCGAAACGCCGAATAT,

 

R: CCGTGGTTCGTGGCTCTCT).

Determination of microsomal reductase activity

For recording the activity of cytochrome b5 reductase and cytochrome P450 reductase, a protocol based on recording tissue chemiluminescence in the presence of lucigenin and NADH or NADPH, respectively, was used. Registration was performed on a Lum-1200 device (DISoft, Russia). The reagents Krebs–Ringer solution (pH 7.4), lucigenin (10,10-dimethyl-9,9-biacridinium dinitrate, Sigma-Aldrich, USA), and NADH and NADPH (Sigma-Aldrich, USA) were used. Before analysis, samples were washed three times with Krebs–Ringer solution, and three portions weighing 15.5±0.5 mg were taken with a 20-G biopsy needle (GTA, Italy). Samples were placed in cuvettes with Krebs–Ringer solution and lucigenin (final concentration, 60 μM), chemiluminescence was recorded at 37°C for 5 min, 10 μl of 10 mM NADH or NADPH was added, and the signal was recorded for 20 min. The average intensity of the stimulated luminescence of INADH and INADPH was calculated for three parallel measurements.

Determination of the oxidative activity of neutrophils

Determination of the oxidative activity of blood neutrophils was performed according to the following method. First, 25 μl of whole blood collected in vacutainers with heparin was placed into a cuvette containing Hanks solution stabilized with HEPES and luminol (45 μM) (all reagents from Sigma-Aldrich, USA), and spontaneous chemiluminescence was recorded for 10 min. Then, a priming stimulus, phorbol 12-myristate 13-acetate (50 ng/ml), was added. After 30 min of incubation, a second stimulus, N-formyl-methionyl-leucyl-phenylalanine (10 μM), was added, and the response was recorded for at least 60 min. The amplitude of the neutrophil response after the two-stage stimulation was calculated. The reference interval for apparently healthy donors (n=110) was determined earlier and was 3.5–9.0 relative units.

Determination of the antioxidant capacity of blood plasma and peritoneal fluid

Chemiluminescence was recorded at 37°C in a system containing the free radical generator 2,2'-azobis(2-amidinopropane) dihydrochloride (ABAP) and a fluorescence activator luminol in a phosphate buffer solution (100 mM, pH 7.4) (all reagents from Sigma-Aldrich, USA). The initial fluorescence was recorded until a plateau was reached; 10 μl of plasma or peritoneal fluid, previously diluted 10 times with phosphate buffer solution (100 mM, pH 7.4), was added; and recording was performed until a new steady-state level was reached. Using PowerGraph 3.0 software (DISoft, Russia), the fluorescence suppression area S was determined, reflecting the antioxidant capacity of water-soluble antioxidants in blood plasma. The reference interval was previously determined for blood plasma (n=98) and is 195–405 relative units. A decrease in S corresponds to a state of oxidative stress.

Statistical processing

The Statistica software package, version 10.0 (StatSoft Inc., USA), was used for statistical data processing. The normality of distribution was tested using the Shapiro–Wilk test. A comparative analysis of two independent groups on a quantitative basis was performed using the Mann–Whitney U test. The differences were considered statistically significant at a value of p ≤0.05. To assess correlations, the Spearman rank correlation coefficient was calculated.

RESULTS

Gene expression

In patients with moderately and poorly differentiated adenocarcinomas of high malignancy (n=10) and in women with benign neoplasms (n=6), gene expression was determined in the tumor tissue, namely, cytochrome b5 reductase (CYB5R1, CYB5R2/R4, CYB5R3), cytochrome P450- reductase (POR), prooxidant enzyme NADPH oxidase 4 (NOX4), antioxidant enzymes superoxide dismutase 1 (SOD1) and heme oxygenase 1 (HMOX1), proinflammatory pathway transcription factor NFKB1, anti-inflammatory pathway transcription factor NRF2, antiapoptotic oncogene protein BCL2, and apoptosis inhibitor BIRC3 (Fig. 1).

 

Fig. 1. Expression of key genes regulating oxidative metabolism in the tissue of ovarian neoplasms in two groups of patients (the average value of the MRNA level of the studied gene in three parallel experiments in relation to the RNA level of the gene of the internal ТВР standard is given).

*Significant differences between groups (p <0.05, nonparametric U-test).

 

Significant differences were obtained for the expression of cytochrome b5 reductase (isoform 3) and the antiapoptotic protein BCL2 (p=0.05). No significant differences were found in the expression of other isoforms of cytochrome b5 reductase (1, 2, 4, and 5), and no significant differences were revealed in the expression of cytochrome P450 reductase.

Microsomal reductase activity

 

Table 1. The intensity of NADH- and NADPH-dependent chemiluminescence in the tissues of ovarian neoplasms (data are given in the form of mean and standard deviation)

Indicator

Benign neoplasms

(n=6)

Ovarian adenocarcinoma

(n=10)

INADH*, rel.units

0.88 (0.55)

7.70 (3.55)

INADPH**, rel.units

1.02 (0.77)

4.40 (2.56)

*IНАДН is proportional to the activity of cytochrome b5 reductase;

**IНАДФН is proportional to the activity of cytochrome P450 reductase.

 

Table 1 presents the results of determining the activity of microsomal reductases in the tissues of ovarian tumors.

The activity of cytochrome b5 reductase and cytochrome P450 reductase was significantly higher in the group of female patients with adenocarcinoma than in those with benign neoplasms, whereas the activity of cytochrome b5 reductase increased by almost an order of magnitude, and the activity of cytochrome P450 reductase increased by four times. Thus, cytochrome b5 reductase is a more sensitive metabolic link in ovarian cancer.

Oxidative activity of blood neutrophils and antioxidant capacity of blood plasma and peritoneal fluid

For each patient, the oxidative activity of neutrophils and the antioxidant capacity of blood plasma and peritoneal fluid were calculated (Table 2).

 

Table 2. Neutrophil activity and antioxidant capacity of blood plasma and peritoneal fluid (data are given in the form of mean and standard deviation), conl. units

Group of patients

Antioxidant capacity S

Activity of the

blood neutrophils

Blood plasma

Peritoneal fluid

With benign neoplasms (n = 6)

370 (88)

333 (110)

5.1 (3.0)

With adenocarcinoma (n = 10)

328 (132)

618 (250)

4.3 (2.1)

 

The activity of blood neutrophils corresponded to the reference values. For blood plasma, the antioxidant capacity values corresponded to the reference interval determined for apparently healthy donors and did not differ between groups. The antioxidant capacity of the peritoneal fluid for the comparison group corresponded to the blood plasma indicators, and in the case of malignant tumors, it approximately doubled.

Correlation between gene expression and indicators of oxidative metabolism

Based on the results of gene expression and previously obtained indicators of oxidative metabolism, correlations were calculated between the expression of the CYB5R and POR genes and activity of the corresponding microsomal reductases; between the expression of the NFKB1 gene and oxidative activity of neutrophils; and between NRF2 gene expression and antioxidant capacity of blood and peritoneal fluid (Table 3).

Table 3. Spearman correlation coefficients between gene expression levels and indicators of oxidative metabolism

Parameter

Gene expressio

CYB53R

POR

NFKB1

NRF2

NRF2

Indicator of oxidative

metabolism

Activity of

cytochrome

b5 reductase

Activity of

cytochrome Р450

reductase

Activity of

neutrophils

Antioxidant

capacity of

plasma

Antioxidant

capacity of

the peritoneal

fluid

Correlation coefficient rs*

−0.19

0.45

0.67

0.36

0.63

*Correlation of average strength is marked in bold in the bottom line: 0,3 rS < 0,7.

 

A weak negative correlation was observed between the expression of CYB5R3 genes and activity of cytochrome b5 reductase. A positive correlation of moderate strength was noted between POR and cytochrome P450 reductase activity. Furthermore, a positive correlation of moderate strength was obtained for the level of expression of the NFKB1 gene with the activity of blood neutrophils, as well as for the NRF2 gene expression level with the antioxidant capacity of blood plasma and peritoneal fluid, and the correlation with the antioxidant capacity of peritoneal fluid was significantly stronger.

DISCUSSION

The main results of the study include decreased expression of the CYB5R3 gene in high-grade adenocarcinoma tissue with increased cytochrome b5 reductase activity by an order of magnitude; absence of significant changes in the expression of the POR gene with several times increased activity of cytochrome P450 reductase; decreased expression of the antiapoptotic protein gene BCL2; direct correlation between neutrophil activity and NFKB1 gene expression; direct correlation between the antioxidant capacity of peritoneal fluid and plasma and NRF2 gene expression; and absence of significant changes in the expression of genes for the oxidative balance enzymes NOX4, SOD1, and HMOX1 and inflammation NFKB1 and NRF2.

No studies have analyzed the expression or activity of microsomal reductases in ovarian cancer. One of the few studies on the function of cytochrome b5 reductase in estrogen-negative breast cancer showed a significant correlation between high expression of CYB5R3 and low relapse-free and overall survival of patients [7]. Our own studies have shown an ambiguous change in the activity of cytochrome b5 reductase and P450 reductase in papillary thyroid cancer, whereas for the most malignant cases, a sharp increase in the activity of these enzymes was registered [9]. Regarding cytochrome P450 reductase, research is mainly being conducted on its role in the metabolism of anticancer drugs because this enzyme can directly reduce substances [10]. The combination of the influence of cytochrome P450 reductase and the use of chemotherapeutic drugs may be a new strategy for treating tumors.

Our studies have shown an increase in the activity of cytochrome P450 reductase in high-grade adenocarcinoma tissues (about four times compared to benign tumors), whereas gene expression has changed insignificantly; however, the positive correlation of these indicators most probably indicates the regulation of the activity of this enzyme at the genetic level. The situation with cytochrome b5 reductase is different, as with a significant decrease in expression, the activity of this enzyme in adenocarcinoma tissue increased by almost an order of magnitude. It can be assumed that cytochrome b5 reductase is more actively involved in carcinogenesis, and this is explained by its multivalued role and localization in the endoplasmic reticulum and on the outer membrane of the mitochondria. In addition to reducing cytochrome b5, cytochrome b5 reductase maintains coenzyme Q10 in a reduced state, thus regulating the intracellular antioxidant balance. It is possible that increased cytochrome b5 reductase activity is a response to intracellular oxidative stress, and decreased gene expression is the result of negative regulatory feedback.

The antiapoptotic protein BCL2, along with BAX and p53, is the main regulator of drug-induced apoptosis, and BCL2 is often overexpressed in adenocarcinoma tissues [11], and the level of this protein in the urine is also increased. The presence of BCL2 expression in ovarian cancer is a favorable prognostic sign, especially in BAX-negative cases [12].

In contrast, Y. Mano et al. have reported that BCL2 expression correlates with poor response to chemotherapy, especially in serous and endometrial adenocarcinomas [13]. Positive expression of BCL2 and p53 in ovarian cancer is closely correlated with pathological stage, metastasis, and recurrence, i.e., with poor prognosis [14]. There is evidence that BCL2 has no prognostic value in terms of response to chemotherapy and survival and is independent of the nature and malignancy of the tumor [15]. Thus, information about the role of BCL2 in the pathogenesis of ovarian cancer and its clinical significance is controversial.

In our study, BCL2 gene expression was reduced in adenocarcinoma tissues, which is consistent with the results of a study [16] that discussed the feasibility of assessing BCL2 expression in conjunction with BAX. Overall, the current standpoint is that proteins in this family may be promising therapeutic targets but must be considered in their entirety.

Moreover, the NF-κB signaling pathway is significant in the pathogenesis of ovarian cancer. The p-STAT3/NF-κB/IL-6 signaling pathway represents a cascade loop involved in angiogenesis in ovarian cancer [17]. Like many participants in oxidative metabolism, the role of this pathway is twofold, as inflammation promotes oncogenesis, proliferation, and survival of tumor cells; in addition, this pathway is a regulator of the expression of antioxidant genes [2]. Our study showed a trend toward increased gene expression, which is consistent with literature data; however, significant differences were not obtained, possibly because of the relatively small size of the groups.

NFKB1 gene expression was positively correlated with neutrophil activity. A recent meta-analysis has proven that an increase in the neutrophil/lymphocyte ratio is a poor prognostic sign in ovarian cancer [18]. Increased neutrophil activity indicates inflammation and may have a beneficial cytotoxic effect [19]; conversely, neutrophils are powerful inflammatory effector cells that promote tumor progression and metastasis, and extracellular neutrophil traps serve as activators of the NF-κB pathway [20]. Oxidative stress, which originated from neutrophils, is closely associated with inflammation and the activity of the NF-κB pathway [21], which is also confirmed by our data. In the present study, we used a new protocol for assessing neutrophil activity, using two-stage stimulation with a priming and main stimulus. This protocol allows the assessment of the full radical-producing potential of a neutrophil, reflecting its maximum activity. For the studied cohort, neutrophil activity on average corresponded to reference values, which confirms the absence of significant systemic inflammation and the absence of a significant increase in NF-κB expression.

The key role of NRF2 in ovarian carcinogenesis has been supported by several studies, with aberrant activation of NRF2 noted in most ovarian cancers, which is often associated with copy number loss in the NRF2 inhibitory complex KEAP1-CUL3-RBX1 [22]. In general, high NRF2 expression is a favorable sign in ovarian cancer [23]. NRF2 regulates the HER1 signaling pathway and modulates the sensitivity of cancer cells to certain anticancer agents, which should be considered when developing treatment strategies. However, NRF2 protects cells from oxidative stress and stimulates tumor growth and resistance to chemotherapy drugs by inactivating the oxidative stress caused by them.

Our studies showed a tendency toward a decrease in NRF2 gene expression in the group of female patients with adenocarcinoma, although significant differences could not be detected. The values of the antioxidant capacity of blood plasma were not beyond the reference interval. A positive correlation between the expression of the NRF2 gene and antioxidant system of the blood and peritoneal fluid confirms their relationship in a single antioxidant–anti-inflammatory system. The antioxidant capacity of plasma is provided primarily by uric acid, and uric acid, according to recent data, functions as an ROS interceptor and at the regulatory level, increasing the expression of mRNA, NRF2 proteins, and NRF2-sensitive genes, including the catalytic subunit of gamma-glutamate-cysteine ligase, heme oxygenase-1, and NQO1 [24]. Uric acid decreases NRF2 ubiquitination and increases NRF2 protein nuclear translocation, thereby activating the KEAP1-NRF2-ARE pathway, whereas the effects of uric acid were significantly suppressed by the NRF2 inhibitor brusatol [25]. Thus, physiological concentrations of uric acid are a regulator of the anti-inflammatory NRF2 pathway; on the contrary, significantly elevated levels of uric acid significantly inhibit autophagy and protein levels of the NRF2/SLC7A11/GPX4 signaling pathway, causing endothelial damage and atherosclerosis [26].

NADPH oxidase is the most crucial source of endogenous superoxide anion radicals in ovarian cancer, whereas epithelial ovarian cancer is characterized by a higher level of NADPH oxidase expression compared with normal ovarian tissues. NOX4 expression is increased in malignant ovarian tumors than in benign ones [27]. Increased NOX4 expression in ovarian cancer is induced by HIF-1 alpha and the insulin-like growth factor IGF-1 [1]. In our study, NOX4 gene expression was slightly reduced in the adenocarcinoma group than in the group of patients with benign tumors; this requires further careful study because the regulation of NOX family genes is complex and determined by a specific cell type.

Gene expression in the antioxidant enzymes SOD1 and HNOX1 was slightly reduced in the group of patients with ovarian cancer. The decrease in SOD1 gene expression is consistent with literature data demonstrating a decrease in the levels of superoxide dismutase, catalase, and low-molecular-weight antioxidants (vitamins C and E) in ovarian cancer [28]. Disorders of heme metabolism in ovarian cancer, primarily in endometriosis-associated cancer, are studied less. Experiments in ovarian cancer cell lines reveal that heme induces heme oxygenase-1 (HO-1) expression. Low levels of exogenous heme promoted the growth of ovarian cancer colonies, and higher doses of heme resulted in slower growth of cancer cell colonies in the induction of HO-1 [29]. Moreover, suppression of the NRF2/HO-1/xCT/GPX4 cytoprotective pathway is the basis of the action of the ferroptosis inducer in ovarian cancer [30]. All this confirms the duality of the effects of participants in oxidative metabolism and the need for a thorough study of its role in carcinogenesis.

CONCLUSION

In high-grade adenocarcinoma tissues, the activity of cytochrome b5 reductase is significantly increased, which can be due to a response to intracellular oxidative stress, whereas expression of the CYB5R3 gene, but not CYB5R1 and CYB5R2\4, is reduced. The decrease in CYB5R3 gene expression may result from negative feedback. Additionally, the activity of cytochrome P450 reductase is increased, but to a lesser extent, and positively correlates with the POR gene expression. Thus, cytochrome b5 reductase is involved in carcinogenesis in ovarian cancer, to a greater extent than cytochrome P450 reductase. The expression levels of the NFKB1 gene did not differ between the groups, but correlated with the activity of blood neutrophils, the levels of which were generally normal. Furthermore, the expression levels of the NRF2 gene did not differ between the groups and correlated with indicators of plasma antioxidant capacity. The correlation with peritoneal fluid antioxidant capacity was significantly stronger, indicating closer metabolic connections at the local level in the peritoneal cavity than at the systemic level.

ADDITIONAL INFO

Author contribution. All authors made a substantial contribution to the conception of the work, acquisition, analysis, interpretation of data for the work, drafting and revising the work, final approval of the version to be published and agree to be accountable for all aspects of the work.

Funding source. This study was not supported by any external sources of funding.

Competing interests. The authors declares that there are no obvious and potential conflicts of interest associated with the publication of this article.

Ethics approval. The study was approved by the Committee on Biomedical Ethics of the Research Centre for Medical Genetics, Moscow (Protocol No. 5 of July 03, 2017).

Consent for publication. All the patients who participated in the study signed the necessary documents on voluntary informed consent to participate in the study and the publication of their medical data.

ДОПОЛНИТЕЛЬНО

Вклад авторов. Все авторы внесли существенный вклад в разработку концепции, проведение исследования и подготовку статьи, прочли и одобрили финальную версию перед публикацией.

Финансирование. Авторы заявляют об отсутствии внешнего финансирования при проведении исследования.

Конфликт интересов. Авторы декларируют отсутствие явных и потенциальных конфликтов интересов, связанных с публикацией настоящей статьи.

Этическое утверждение. Исследование одобрено Комитетом по биомедицинской этике Медико-генетического научного центра им. академика Н.П. Бочкова (протокол № 5 от 03 июля 2017 года).

Информированное согласие на публикацию. Все пациентки, участвовавшие в исследовании, подписали необходимые документы о добровольном информированном согласии на участие в исследовании и публикацию их медицинских данных.

×

About the authors

Elena V. Proskurnina

Research Centre for Medical Genetics

Email: proskurnina@gmail.com
ORCID iD: 0000-0002-8243-6339

MD, Dr. Sci. (Med.), assistant professor, Chief Researcher

Russian Federation, 1, Moskvorechye str., 15522, Moscow

Mariya V. Fedorova

Central Research Institute for Epidemiology

Email: theklazontag@yandex.ru
ORCID iD: 0000-0002-7859-6698

MD, obstetrician-gynecologist

Russian Federation, Moscow

Ekaterina A. Savinova

Research Centre for Medical Genetics

Email: savinova.ekaterina96@yandex.ru
ORCID iD: 0000-0001-5286-516X

MD, research associate

Russian Federation, 1, Moskvorechye str., 15522, Moscow

Vladimir I. Voznesenskii

D.D. Pletnev City Clinical Hospital

Email: vlad525@gmail.com
ORCID iD: 0000-0002-5135-0997

MD, Cand. Sci. (Med.), oncologist, obstetrician-gynecologist

Russian Federation, Moscow

Svetlana V. Kostyuk

Research Centre for Medical Genetics

Author for correspondence.
Email: svet-vk@yandex.ru
ORCID iD: 0000-0002-6336-9900

MD, Dr. Sci. (Med.), assistant professor, Head of the Laboratory

Russian Federation, 1, Moskvorechye str., 15522, Moscow

Elena A. Sosnova

I.M. Sechenov First Moscow State Medical University (Sechenov University)

Email: sosnova-elena@inbox.ru
ORCID iD: 0000-0002-1732-6870
SPIN-code: 6313-9959

MD, Dr. Sci. (Med.), Professor

Russian Federation, Moscow

References

  1. Liu WJ, Huang YX,Wang W, et al. NOX4 Signaling Mediates Cancer Development and Therapeutic Resistance through HER3 in Ovarian Cancer Cells. Cells. 2021;10(7):1647. doi: 10.3390/cells10071647
  2. Ding DN, Xie LZ, Shen Y, et al. Insights into the Role of Oxidative Stress in Ovarian Cancer. Oxid Med Cell Longev. 2021;2021:8388258. doi: 10.1155/2021/8388258
  3. Strycharz-Dudziak M, Foltyn S, Dworzanski J, et al. Glutathione Peroxidase (GPx) and Superoxide Dismutase (SOD) in Oropharyngeal Cancer Associated with EBV and HPV Coinfection. Viruses. 2020;12(9):1008. doi: 10.3390/v12091008
  4. Singh N, Baby D, Rajguru JP, et al. Inflammation and cancer. Ann Afr Med. 2019;18(3):121–126. doi: 10.4103/aam.aam_56_18
  5. Sprooten J, Vankerckhoven A, Vanmeerbeek I, et al. Peripherally-driven myeloid NFkB and IFN/ISG responses predict malignancy risk, survival, and immunotherapy regime in ovarian cancer. J Immunother Cancer. 2021;9(11):e003609. doi: 10.1136/jitc-2021-003609
  6. Elahian F, Sepehrizadeh Z, Moghim B, Mirzaei SA. Human cytochrome b5 reductase: structure, function, and potential applications. Crit Rev Biotechnol. 2014;34(2):134–143.doi: 10.3109/07388551.2012.732031
  7. Lund RR, Leth-Larsen R, Caterino TD, et al. NADH-Cytochrome b5 Reductase 3 Promotes Colonization and Metastasis Formation and Is a Prognostic Marker of Disease-Free and Overall Survival in Estrogen Receptor-Negative Breast Cancer. Mol Cell Proteomics. 2015;14(11):2988–2999. doi: 10.1074/mcp.M115.050385
  8. Wisniewska A, Jagiello K, Mazerska Z. NADPH-cytochrome P450 reductase, not only the partner of cytochrome P450. Postepy Biochem. 2009;55(3):272–278.
  9. Proskurnina EV, Fedorova MV, Sozarukova MM, et al. Microsomal reductase activity in patients with thyroid neoplasms. Endocrine. 2021;72(3):735–743. doi: 10.1007/s12020-020-02513-z
  10. Saunders MP, Patterson AV, Chinje EC, Harris AL, Stratford IJ. NADPH:cytochrome c (P450) reductase activates tirapazamine (SR4233) to restore hypoxic and oxic cytotoxicity in an aerobic resistant derivative of the A549 lung cancer cell line. Br J Cancer. 2000;82(3):651–656. doi: 10.1054/bjoc.1999.0977
  11. Eliopoulos AG, Kerr DJ, Herod J, et al. The control of apoptosis and drug resistance in ovarian cancer: influence of p53 and Bcl-2. Oncogene. 1995;11(7):1217–1228.
  12. Marx D, Binder C, Meden H, et al. Differential expression of apoptosis associated genes bax and bcl-2 in ovarian cancer. Anticancer Res. 1997;17(3C):2233–2240.
  13. Mano Y, Kikuchi Y, Yamamoto K, et al. Bcl-2 as a predictor of chemosensitivity and prognosis in primary epithelial ovarian cancer. Eur J Cancer. 1999;35(8):1214–1219.doi: 10.1016/s0959-8049(99)00124-0
  14. Liang M, Zhao J. Protein expressions of AIB1, p53 and Bcl-2 in epithelial ovarian cancer and their correlations with the clinical pathological features and prognosis. Eur Rev Med Pharmacol Sci. 2018;22(16):5134–5139. doi: 10.26355/eurrev_201808_15708
  15. Baekelandt M, Kristensen GB, Nesland JM, Trope CG, Holm R. Clinical significance of apoptosis-related factors p53, Mdm2, and Bcl-2 in advanced ovarian cancer. J Clin Oncol. 1999;17(7):2061.doi: 10.1200/JCO.1999.17.7.2061
  16. Chaudhry P, Srinivasan R, Patel FD. Differential expression of Fas family members and Bcl-2 family members in benign versus malignant epithelial ovarian cancer (EOC) in North Indian population. Mol Cell Biochem. 2012;368(1–2):119–126.doi: 10.1007/s11010-012-1350-7
  17. Chen C, You F, Wu F, et al. Antiangiogenesis Efficacy of Ethanol Extract from Amomum tsaoko in Ovarian Cancer through Inducing ER Stress to Suppress p-STAT3/NF-kB/IL-6 and VEGF Loop. Evid Based Complement Alternat Med. 2020;2020:2390125.doi: 10.1155/2020/2390125
  18. Chen G, Zhu L, Yang Y, et al. Prognostic Role of Neutrophil to Lymphocyte Ratio in Ovarian Cancer: A Meta-Analysis. Technol Cancer Res Treat. 2018;17:1533033818791500.doi: 10.1177/1533033818791500
  19. Lichtenstein A, Seelig M, Berek J, Zighelboim J. Human neutrophil-mediated lysis of ovarian cancer cells. Blood. 1989;74(2): 805–809.
  20. Klink M, Jastrzembska K, Nowak M, et al. Ovarian cancer cells modulate human blood neutrophils response to activation in vitro. Scand J Immunol. 2008;68(3):328–336.doi: 10.1111/j.1365-3083.2008.02139.x
  21. Tobon-Velasco JC, Cuevas E, Torres-Ramos MA. Receptor for AGEs (RAGE) as mediator of NF-kB pathway activation in neuroinflammation and oxidative stress. CNS Neurol Disord Drug Targets. 2014;13(9):1615–1626.doi: 10.2174/1871527313666140806144831
  22. Van der Wijst MGP, Brown R, Rots MG. Nrf2, the master redox switch: the Achilles’ heel of ovarian cancer? Biochim Biophys Acta. 2014;1846(2):494–509. doi: 10.1016/j.bbcan.2014.09.004
  23. Cho HY, Kim K, Kim YB, Kim H, No JH. Expression Patterns of Nrf2 and Keap1 in Ovarian Cancer Cells and their Prognostic Role in Disease Recurrence and Patient Survival. Int J Gynecol Cancer. 2017;27(3):412–419. doi: 10.1097/IGC.0000000000000908
  24. Huang TT, Hao DL, Wu BN, Mao LL, Zhang J. Uric acid demonstrates neuroprotective effect on Parkinson’s disease mice through Nrf2-ARE signaling pathway. Biochem Biophys Res Commun. 2017;493(4):1443–1449. doi: 10.1016/j.bbrc.2017.10.004
  25. Lin Y, Xie Y, Hao Z, et al. Protective Effect of Uric Acid on ox-LDL-Induced HUVECs Injury via Keap1-Nrf2-ARE Pathway. J Immunol Res. 2021;2021:5151168. doi: 10.1155/2021/5151168
  26. Jiang Z, Fletcher NM, Ali-Fehmi R, et al. Modulation of redox signaling promotes apoptosis in epithelial ovarian cancer cells. Gynecol Oncol. 2011;122(2):418–423. doi: 10.1016/j.ygyno.2011.04.051
  27. Ghazy AA, El-Etreby NM, Rashad R, Moussa N. Role of Oxidative Stress in Prognosis of Ovarian Cancer. Egypt J Immunol. 2020;27(2):31–38.
  28. Senthil K, Aranganathan S, Nalini N. Evidence of oxidative stress in the circulation of ovarian cancer patients. Clin Chim Acta. 2004;339(1–2):27–32. doi: 10.1016/j.cccn.2003.08.017
  29. Hecht JL, Janikova M, Choudhury R, et al. Labile Heme and Heme Oxygenase-1 Maintain Tumor-Permissive Niche for Endometriosis-Associated Ovarian Cancer. Cancers (Basel). 2022;14(9):2242. doi: 10.3390/cancers14092242
  30. Jing T, Guo Y, Wei Y. Carboxymethylated pachyman induces ferroptosis in ovarian cancer by suppressing NRF1/HO-1 signaling. Oncol Lett. 2022;23(5):161. doi: 10.3892/ol.2022.13281.

Supplementary files

Supplementary Files
Action
1. JATS XML
2. Fig. 1. Expression of key genes regulating oxidative metabolism in the tissue of ovarian neoplasms in two groups of patients (the average value of the MRNA level of the studied gene in three parallel experiments in relation to the RNA level of the gene of the internal ТВР standard is given).

Download (108KB)

Copyright (c) 2023 Eco-Vector



СМИ зарегистрировано Федеральной службой по надзору в сфере связи, информационных технологий и массовых коммуникаций (Роскомнадзор).
Регистрационный номер и дата принятия решения о регистрации СМИ:
ПИ № ФС 77 - 86335 от 11.12.2023 г.  
СМИ зарегистрировано Федеральной службой по надзору в сфере связи, информационных технологий и массовых коммуникаций (Роскомнадзор).
Регистрационный номер и дата принятия решения о регистрации СМИ:
ЭЛ № ФС 77 - 80633 от 15.03.2021 г.